View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20505_low_29 (Length: 260)
Name: NF20505_low_29
Description: NF20505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20505_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 4316485 - 4316244
Alignment:
| Q |
1 |
gggtgttgtagagggattgaaaatttggagctttggggttcagctgtgaaatggggttctgagtttaagtttaatacttctgaagaatgttgtaattctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4316485 |
gggtgttgtagagggattgaaaatttggagctttggggttcagctgtgaaatggggttccgagtttaagtttaatacttctgaagaatgttgtaattctt |
4316386 |
T |
|
| Q |
101 |
gtaaatctatgtgtactgggaaagatggaccttgtctttgtgatacttgggtcttttgtgggaatcgggaggcttgtggatccaaattcggcgaggtacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4316385 |
gtaaatctatgtgtactgggaaagatggaccttgtctttgtgatacatgggtcttttgtgggaatcgggaggcttgtggatccaaattcggcgaggtact |
4316286 |
T |
|
| Q |
201 |
ttgcccgttcttgtccatagagacactgacgcatgtggttac |
242 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4316285 |
ttgcccgttcctgtccatagagacactgacgcatgtggttac |
4316244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 7 - 94
Target Start/End: Complemental strand, 30971447 - 30971360
Alignment:
| Q |
7 |
tgtagagggattgaaaatttggagctttggggttcagctgtgaaatggggttctgagtttaagtttaatacttctgaagaatgttgta |
94 |
Q |
| |
|
||||||||| |||| ||||||| || |||||| ||||||||||||||| ||| |||||| ||||| ||||||| |||||||||| |
|
|
| T |
30971447 |
tgtagaggggttgagcatttggaactatggggtgatgctgtgaaatggggtgatgattttaaggttaattcttctgaggaatgttgta |
30971360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University