View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20505_low_33 (Length: 237)

Name: NF20505_low_33
Description: NF20505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20505_low_33
NF20505_low_33
[»] chr8 (2 HSPs)
chr8 (101-216)||(31435229-31435344)
chr8 (1-53)||(31435085-31435137)


Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 101 - 216
Target Start/End: Original strand, 31435229 - 31435344
Alignment:
101 aaaacctctgggctaggtccattctatgggctttatattttgcaactaatctactttgcaagacaaagagaacaaggaaattcctttttggacccgttta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||    
31435229 aaaacctctgggctaggtccattctatgggctttatattttgcaactaatctactttgcaagacaaagagaacaaggaaattcctttttcgaccccttta 31435328  T
201 attgctcacagccgct 216  Q
    ||||||||||||||||    
31435329 attgctcacagccgct 31435344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 31435085 - 31435137
Alignment:
1 ttttatgactaaaagtttagaagtatagtttaagaatattcaaaagcttttgt 53  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
31435085 ttttatgactaaaagtttagaagtatagtttaagaatattcaaaagcttttgt 31435137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University