View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20507_high_12 (Length: 240)
Name: NF20507_high_12
Description: NF20507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20507_high_12 |
 |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0018 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 20 - 205
Target Start/End: Complemental strand, 147943 - 147758
Alignment:
| Q |
20 |
gctgactctatgtatgtcgacactaactcacactggggcatggagctgagcgctaggcaacaatattgtgcacccgggcaagcgccgagtacgtttctgt |
119 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
147943 |
gctgactctatgtatgtcgacactacctcacactggggcatggagctgagcgctaggcaacaatattgtgcgcccgggcaagcgccgagtacgtttctgt |
147844 |
T |
 |
| Q |
120 |
gcattccgaaaacatgtgttataaatatactagcagcctgcaggatatccgtgcatacttacgggtgagcgtgttacactcttata |
205 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||| |||||||||||| | |||||||| |
|
|
| T |
147843 |
gcattctgaaaacatgtgttataaatatactagcagccagcaggatatccatgcatacgtaccggtgagcgtgttgcgctcttata |
147758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University