View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20507_high_7 (Length: 284)
Name: NF20507_high_7
Description: NF20507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20507_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 17 - 275
Target Start/End: Complemental strand, 10911569 - 10911328
Alignment:
| Q |
17 |
agattgctcatgttacggagaagagatgttgaacgttgaagggttgttgttgttgctttcagtattgatcttagaattgccatggttgctatcnnnnnnn |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||| |||||| ||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
10911569 |
agattgctcatgttacggagaagagatgatgaacgatgaagggtttttgttg---ctttcagcattgatcttagaattgccatggttgctttcagagaga |
10911473 |
T |
|
| Q |
117 |
nnnnnnnnnnnnctcaactacttccttttttgggtagttcctatgtacttactttacttgtgatgattccttgatgcatgagaatttggttttcgcttcc |
216 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10911472 |
gagagaga----ctcaactacttccttttttgg-tagttcctatgtactt---------gtgatgattcgttgatgcatgagaatttggttttcgcttcc |
10911387 |
T |
|
| Q |
217 |
tacgtggcagggtattttggtagtttcataaaccatttttcagtcctttcgctctctgc |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10911386 |
tacgtggcagggtattttggtagtttcataaaccttttttcagtcctttcgctctctgc |
10911328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 17 - 105
Target Start/End: Original strand, 13724618 - 13724706
Alignment:
| Q |
17 |
agattgctcatgttacggagaagagatgttgaacgttgaagggttgttgttgttgctttcagtattgatcttagaattgccatggttgc |
105 |
Q |
| |
|
|||||||||||||||| ||||| ||||| |||||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13724618 |
agattgctcatgttacagagaaaagatgatgaacgatgaagggttgtttttgttgctttcgttattgatcttagaattgccatggttgc |
13724706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University