View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20507_low_11 (Length: 248)
Name: NF20507_low_11
Description: NF20507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20507_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 34552336 - 34552123
Alignment:
| Q |
18 |
cattgctacattaccttatgcgatgtgtatttaggttacttcattttctatcatattagattttccaaacgaaatgtgcgtactttttatgttattgatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| || |
|
|
| T |
34552336 |
cattgctacattaccttatgcgatgtgtatttaggttacttcattttctatcatattagatctcccaaacgaaatgtgcgtactttttatgttattg-tg |
34552238 |
T |
|
| Q |
118 |
gattagattgttttgtatgaagttaagtaatgactaaaattgaagctagtattgttttgattatctaattctattggtcattgatattttttgagtttta |
217 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34552237 |
gattagattgtttggtatgaagttaagtaatgactataattgaagctagtattgtttcgattatctaattctattggtcattgatgttttttgagtttta |
34552138 |
T |
|
| Q |
218 |
caatgaattaatttt |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34552137 |
caatgaattaatttt |
34552123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University