View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20507_low_12 (Length: 240)

Name: NF20507_low_12
Description: NF20507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20507_low_12
NF20507_low_12
[»] scaffold0018 (1 HSPs)
scaffold0018 (20-205)||(147758-147943)


Alignment Details
Target: scaffold0018 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 20 - 205
Target Start/End: Complemental strand, 147943 - 147758
Alignment:
20 gctgactctatgtatgtcgacactaactcacactggggcatggagctgagcgctaggcaacaatattgtgcacccgggcaagcgccgagtacgtttctgt 119  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
147943 gctgactctatgtatgtcgacactacctcacactggggcatggagctgagcgctaggcaacaatattgtgcgcccgggcaagcgccgagtacgtttctgt 147844  T
120 gcattccgaaaacatgtgttataaatatactagcagcctgcaggatatccgtgcatacttacgggtgagcgtgttacactcttata 205  Q
    |||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||| |||||||||||| | ||||||||    
147843 gcattctgaaaacatgtgttataaatatactagcagccagcaggatatccatgcatacgtaccggtgagcgtgttgcgctcttata 147758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University