View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20507_low_17 (Length: 225)
Name: NF20507_low_17
Description: NF20507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20507_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 50675716 - 50675509
Alignment:
| Q |
1 |
ttcaaattaaaaggtacacacatgaaattgcctcgcaaatgcatcatatccacaacttccgatgagtagagttgtaaacagtttaacagacctataaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50675716 |
ttcaaattaaaaggtacacacatgaaattgcctcgcaaatgcatcatatccacaacttctgatgagtagagttgtaaacagtttaacagacctataaaat |
50675617 |
T |
 |
| Q |
101 |
attgtatcaatataaaatccaagcaatagtgtcaatgttacattatttagttactgtcaagccaaactattatgctcgcctataagaatgtgatataacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
50675616 |
attgtatcaatataaaatccaagcaataatgtcaatgttacattatttagttactgtcaagccaaactgttatgcttgcctataagaatgtgatataacc |
50675517 |
T |
 |
| Q |
201 |
aacatcat |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
50675516 |
aacatcat |
50675509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University