View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20507_low_5 (Length: 303)
Name: NF20507_low_5
Description: NF20507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20507_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 8e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 64 - 287
Target Start/End: Complemental strand, 10069266 - 10069044
Alignment:
| Q |
64 |
attacaaacataaacaaaataaataatgaaattggataatgattttatagccatgcagcacttatagtcatacataaaatagcttaccnnnnnnnnctag |
163 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
10069266 |
attacaaacataaacaacctaaataatgaaattggataatcattttatagccatgcaccacttatagtcatacataaaatagcttaccttttttt-ctag |
10069168 |
T |
|
| Q |
164 |
ttatgtgtgaactcaaaaattctaatttcaagatggattttgcagggttgcagtgaattttctgttgttcaagtaaagtgtatttcctataaagcatgac |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10069167 |
ttatgtgtgaactcaaaaattctaatttcaagatggatttttcagggatgcagtgaattttctgttgttcaagtaaagtgtatttcctataaagcatgac |
10069068 |
T |
|
| Q |
264 |
tacaaatgaaaagaaatttgtgag |
287 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
10069067 |
tacaaatgaaaagaaatttgtgag |
10069044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University