View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20508_low_3 (Length: 425)
Name: NF20508_low_3
Description: NF20508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20508_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 38 - 406
Target Start/End: Original strand, 51770691 - 51771054
Alignment:
| Q |
38 |
caaatttcattataccatcaagaaagaaagaa----gtgttgttggtgaaatgaatgaatgaaagaaaaggtagtaagtaatatttgnnnnnnnnnnnnn |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51770691 |
caaatttcattataccatcaagaaagaaagaaagaagtgttgttggtgaaatgaatgaatgaaagaaaaggtagt----aatatttgtatataatataat |
51770786 |
T |
 |
| Q |
134 |
nnnnnnngcctggcttcaacctgtctgccttaatggacgcaaatgcaatggtacgatgtcaatgtctgatgagcaacgaggttgttgttggatttgcaaa |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51770787 |
at-----gcctggcttcaacctgtctgccttaatggacgcaaatgcaatggtacgatgtcaatgtctgatgagcaacgaggttgttgttggatttgcaaa |
51770881 |
T |
 |
| Q |
234 |
gagaaccaccacctgtttgtgagcaagggtataagggtcattgcatgttgctgctagnnnnnnnnnnnnnnnnnnngtggaagaagatgaaacaaccacc |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
51770882 |
gagaaccaccacctgtttgtgagcaagggtataagggtcattgcatgctgctagtactactactactactactactgtggaagaagatgaaacaaccacc |
51770981 |
T |
 |
| Q |
334 |
gccaccgtgtccaccacaaacacatccattgctggtggctgtaaaacagaatgaaaatgatgatagtcaagcc |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
51770982 |
gccaccgtgtccaccacaaacacatccattgctggtagctgtaaaacagaatgaaaatgatgatagtcaagcc |
51771054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University