View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20509_high_13 (Length: 247)
Name: NF20509_high_13
Description: NF20509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20509_high_13 |
 | |
|
| [»] scaffold0085 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0085 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 52861 - 53056
Alignment:
| Q |
1 |
ttatggcttgaatcaacaggaaatagtcattcctacacttgtaaattcaattttgttacatatgcaagttgaatgattgcacaaaattttcaacttg--a |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
52861 |
ttatggcttgaatcaacaggaaatagtcattcctacacttgtaaattcaattttgttacatatgcaagttgaatgattgcacaaaattttcaacttggta |
52960 |
T |
|
| Q |
99 |
tgcttatgctcagcacaatctttgcaacttatactcaattaactattgttgaaaattctctactgcattaagaaactggaaagcctgattggaggc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52961 |
tgcttatgctcagcacaatctttgcaacttatactcaattaactattgttgaaaattctctactgcattaagaaactggaaagcctgattggaggc |
53056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 45 - 96
Target Start/End: Original strand, 17817614 - 17817665
Alignment:
| Q |
45 |
attcaattttgttacatatgcaagttgaatgattgcacaaaattttcaactt |
96 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
17817614 |
attcaatttggttacatatgcaagttgaataattgcacaaaatttttaactt |
17817665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University