View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20509_high_3 (Length: 427)
Name: NF20509_high_3
Description: NF20509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20509_high_3 |
 |  |
|
| [»] scaffold0396 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 323; Significance: 0; HSPs: 16)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 1 - 412
Target Start/End: Original strand, 836704 - 837109
Alignment:
| Q |
1 |
ttcatggtgatcagttataaggacaaaaatatcatcaaatccaaaaatttaaatactctcgcaggtaaatttggattatgattnnnnnnnttgatccagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| ||| |||||||||| |
|
|
| T |
836704 |
ttcatggtgatcagttataaggacaaaaatatcattaaatccaaaaatttaaatactctcgcag----atttggattatcattaaaaaaattgatccagt |
836799 |
T |
 |
| Q |
101 |
ctacttttatgcggtttaatttggatcgatttttggatatccaatttacagttttgtgaaaaaatctattaaaattactactataaagtcacgataaaat |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
836800 |
ctacttttatgcggtttaatttgaatcgatttttcgatatccaatttacaattttgtgaaaaaatctattaaaattactactataaagtcacgataaaat |
836899 |
T |
 |
| Q |
201 |
caagttgaaatattatctctctaatgcctatacaggggatgagtagctcacttggttgagttgattaaagaaattaaggacttaaatgtctagcctagta |
300 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
836900 |
caagttgaaatattatctc--taatgcctatacagaggatgagtagctcacttggtttagttgattaaagaaattaaggacttaaatgtctagcctagta |
836997 |
T |
 |
| Q |
301 |
agataggaaatactaacataaaaattaacgtactaattttatgagcttcaggttatccatcgtagacttctattggttaaagagatgaatcttcaagatg |
400 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
836998 |
agataggaaatactaacgtaaaaattaacgtactaattttacgagcttcaggttatccatcgcagacttctattggttaaagagatgaatcttcaagatg |
837097 |
T |
 |
| Q |
401 |
ttatttgctatt |
412 |
Q |
| |
|
|||||||||||| |
|
|
| T |
837098 |
ttatttgctatt |
837109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 113 - 177
Target Start/End: Complemental strand, 11383296 - 11383232
Alignment:
| Q |
113 |
ggtttaatttggatcgatttttggatatccaatttacagttttgtgaaaaaatctattaaaatta |
177 |
Q |
| |
|
|||||| |||||||| ||||||||||||| || ||| | |||||||||||||||||||||||||| |
|
|
| T |
11383296 |
ggtttagtttggatcaatttttggatatcaaaattataattttgtgaaaaaatctattaaaatta |
11383232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 7700680 - 7700644
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7700680 |
tatgcggtttaatttggatcgatttttggatatccaa |
7700644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 144
Target Start/End: Original strand, 670487 - 670519
Alignment:
| Q |
112 |
cggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
670487 |
cggtttaatttggatcgatttttggatatccaa |
670519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 9280321 - 9280285
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9280321 |
tatgcggtttaatttggatcggtttttggatatccaa |
9280285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 18780642 - 18780678
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18780642 |
tatgcggtttaatttggatcaatttttggatatccaa |
18780678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 24319455 - 24319419
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24319455 |
tatgcggtttaatttggatcggtttttggatatccaa |
24319419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 24574867 - 24574903
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24574867 |
tatgcggtttaatttggatcggtttttggatatccaa |
24574903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 56078824 - 56078788
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
56078824 |
tatgcggtttaatttggatcgatttttggacatccaa |
56078788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 143
Target Start/End: Complemental strand, 42430399 - 42430364
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatcca |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42430399 |
tatgcggtttaatttggatcgatttttggacatcca |
42430364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 112 - 150
Target Start/End: Original strand, 15726569 - 15726607
Alignment:
| Q |
112 |
cggtttaatttggatcgatttttggatatccaatttaca |
150 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
15726569 |
cggtttaatttggatcggtttttggatatccaaattaca |
15726607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 111 - 144
Target Start/End: Complemental strand, 19615068 - 19615035
Alignment:
| Q |
111 |
gcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
19615068 |
gcggtttaatttggatcgatttttggttatccaa |
19615035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 108 - 141
Target Start/End: Original strand, 23695618 - 23695651
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatc |
141 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
23695618 |
tatgcggtttaatttggatcggtttttggatatc |
23695651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 150
Target Start/End: Complemental strand, 35747677 - 35747636
Alignment:
| Q |
109 |
atgcggtttaatttggatcgatttttggatatccaatttaca |
150 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| || ||||| |
|
|
| T |
35747677 |
atgcggtttaatttggatcggtttttggatatcaaaattaca |
35747636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 31567847 - 31567883
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
31567847 |
tatgcggttttatttggatcggtttttggatatccaa |
31567883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 42414257 - 42414293
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
42414257 |
tatgcggtttaatttggatcggtttttggatgtccaa |
42414293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 1e-20; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 91 - 202
Target Start/End: Complemental strand, 32631666 - 32631556
Alignment:
| Q |
91 |
ttgatccagtctacttttatgcggtttaatttggatcgatttttggatatccaatttacagttttgtgaaaaaatctattaaaattactactataaagtc |
190 |
Q |
| |
|
||||| || |||| |||||||||||||||||||||| |||||||| |||||| ||||| ||||||| |||||||||||||||||| || ||| ||| | |
|
|
| T |
32631666 |
ttgatacaatctaattttatgcggtttaatttggatatgtttttggacatccaaattacaattttgtggaaaaatctattaaaattaatattat-aagac |
32631568 |
T |
 |
| Q |
191 |
acgataaaatca |
202 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32631567 |
acgataaaatca |
32631556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 107 - 202
Target Start/End: Original strand, 17199832 - 17199926
Alignment:
| Q |
107 |
ttatgcggtttaatttggatcgatttttggatatccaatttacagttttgtgaaaaaatctattaaaattactactataaagtcacgataaaatca |
202 |
Q |
| |
|
||||||| |||| ||||||| || |||||||||| ||| ||||||||||||| |||||| ||||||||||| || ||||||| ||||| ||||||| |
|
|
| T |
17199832 |
ttatgcgttttagtttggattgacttttggatatacaaattacagttttgtg-aaaaatatattaaaattattattataaagacacgaaaaaatca |
17199926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 16672409 - 16672373
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16672409 |
tatgcggtttaatttggatcggtttttggatatccaa |
16672373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 143
Target Start/End: Complemental strand, 22596749 - 22596714
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatcca |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22596749 |
tatgcggtttaatttggatcgatttttggacatcca |
22596714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 21352009 - 21352045
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
21352009 |
tatgcggtttaatttggatcggtttttggatgtccaa |
21352045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 140
Target Start/End: Complemental strand, 29772604 - 29772572
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatat |
140 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
29772604 |
tatgcggtttaatttggatcggtttttggatat |
29772572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000003; HSPs: 11)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 108 - 161
Target Start/End: Original strand, 40211253 - 40211306
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaatttacagttttgtgaaa |
161 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||| |||| ||||| |
|
|
| T |
40211253 |
tatgcggtttagtttggatcgatttttggatatccaaattacaattttatgaaa |
40211306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 5559781 - 5559745
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5559781 |
tatgtggtttaatttggatcgatttttggatatccaa |
5559745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 14462098 - 14462062
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14462098 |
tatgcggtttaatttggatcggtttttggatatccaa |
14462062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 140
Target Start/End: Complemental strand, 28655974 - 28655942
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatat |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28655974 |
tatgcggtttaatttggatcgatttttggatat |
28655942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 150
Target Start/End: Complemental strand, 7005095 - 7005054
Alignment:
| Q |
109 |
atgcggtttaatttggatcgatttttggatatccaatttaca |
150 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||| ||||| |
|
|
| T |
7005095 |
atgcggtttaatttggatcgaattttggatgtccaaattaca |
7005054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 24063609 - 24063645
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
24063609 |
tatgcggtttaatttggattggtttttggatatccaa |
24063645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 140
Target Start/End: Original strand, 31088614 - 31088646
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatat |
140 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
31088614 |
tatgcggtttaatttggttcgatttttggatat |
31088646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 33111430 - 33111394
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33111430 |
tatgcggtttaatttaaatcgatttttggatatccaa |
33111394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 33719292 - 33719328
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
33719292 |
tatgcggtttaatttggatcggtttttgaatatccaa |
33719328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 35671807 - 35671843
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
35671807 |
tatgcagtttaatttggatcggtttttggatatccaa |
35671843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 41198207 - 41198243
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
41198207 |
tatgcgatttaatttggatcggtttttggatatccaa |
41198243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.00000000001; HSPs: 10)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 19636255 - 19636291
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19636255 |
tatgcggtttaatttggatcgatttttggatatccaa |
19636291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 48082593 - 48082629
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48082593 |
tatgcggtttaatttggatcgatttttggatatccaa |
48082629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 109 - 150
Target Start/End: Original strand, 32033752 - 32033793
Alignment:
| Q |
109 |
atgcggtttaatttggatcgatttttggatatccaatttaca |
150 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
32033752 |
atgcggtttaatttggatcggtttttggatatccaaattaca |
32033793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 1030877 - 1030841
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1030877 |
tatgcggtttaatttggatcgatttttggatgtccaa |
1030841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 106 - 176
Target Start/End: Original strand, 31938503 - 31938573
Alignment:
| Q |
106 |
tttatgcggtttaatttggatcgatttttggatatccaatttacagttttgtgaaaaaatctattaaaatt |
176 |
Q |
| |
|
||||||| ||||| |||||||||||| || ||||||||| | ||| |||| | |||| ||||||||||||| |
|
|
| T |
31938503 |
tttatgcagtttagtttggatcgattgtttgatatccaaataacaattttttcaaaagatctattaaaatt |
31938573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 150
Target Start/End: Original strand, 34711583 - 34711624
Alignment:
| Q |
109 |
atgcggtttaatttggatcgatttttggatatccaatttaca |
150 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
34711583 |
atgcagtttaaattggatcgatttttggatatccaaattaca |
34711624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 144
Target Start/End: Complemental strand, 29283373 - 29283341
Alignment:
| Q |
112 |
cggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
29283373 |
cggtttaatttggatcggtttttggatatccaa |
29283341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 37282357 - 37282393
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
37282357 |
tatgcggtttaatttggattggtttttggatatccaa |
37282393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 39716954 - 39716990
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
39716954 |
tatgcggtttattttggatcgatttttggacatccaa |
39716990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 48973449 - 48973485
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
48973449 |
tatgcggtttaatttggatcggttttttgatatccaa |
48973485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000006; HSPs: 9)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 109 - 150
Target Start/End: Original strand, 20209746 - 20209787
Alignment:
| Q |
109 |
atgcggtttaatttggatcgatttttggatatccaatttaca |
150 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
20209746 |
atgcggtttaatttggatcaatttttggatatccaaattaca |
20209787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 150
Target Start/End: Original strand, 1274173 - 1274209
Alignment:
| Q |
114 |
gtttaatttggatcgatttttggatatccaatttaca |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1274173 |
gtttaatttggatcgatttttggatatccaaattaca |
1274209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 40987736 - 40987700
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40987736 |
tatgcggtttaatttggatcggtttttggatatccaa |
40987700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 115 - 150
Target Start/End: Original strand, 16038229 - 16038264
Alignment:
| Q |
115 |
tttaatttggatcgatttttggatatccaatttaca |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16038229 |
tttaatttggatcgatttttggatatccaaattaca |
16038264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 1495577 - 1495613
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
1495577 |
tatgcggtttaatttggatcggtttttggacatccaa |
1495613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 123 - 175
Target Start/End: Complemental strand, 7016233 - 7016181
Alignment:
| Q |
123 |
ggatcgatttttggatatccaatttacagttttgtgaaaaaatctattaaaat |
175 |
Q |
| |
|
||||| |||||| |||||||| ||||| || ||||||||||||||||||||| |
|
|
| T |
7016233 |
ggatcaattttttaatatccaaattacaattgtgtgaaaaaatctattaaaat |
7016181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 7946480 - 7946516
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
7946480 |
tatgcggtttaatttggattgattttgggatatccaa |
7946516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 13555166 - 13555130
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
13555166 |
tatgcggtttaatttagatcggtttttggatatccaa |
13555130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 17342167 - 17342203
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17342167 |
tatgcggtttaatttggatcggattttggatatccaa |
17342203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 9)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 1265502 - 1265466
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1265502 |
tatgcggtttaatttggatcggtttttggatatccaa |
1265466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 6345693 - 6345657
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6345693 |
tatgcggtttaatttggatcggtttttggatatccaa |
6345657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 10182920 - 10182956
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10182920 |
tatgcggtttaatttggatcggtttttggatatccaa |
10182956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 26720867 - 26720903
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26720867 |
tatgcggtttaatttggatcggtttttggatatccaa |
26720903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 31126970 - 31127006
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31126970 |
tatgcggtttaatttggatcggtttttggatatccaa |
31127006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 37948654 - 37948690
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37948654 |
tatgcggtttaatttggatcggtttttggatatccaa |
37948690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 43619749 - 43619785
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43619749 |
tatgcggtttaatttggatcggtttttggatatccaa |
43619785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 13471261 - 13471225
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
13471261 |
tatgcggtttaatttggatcggtttttgaatatccaa |
13471225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 109 - 141
Target Start/End: Original strand, 42199795 - 42199827
Alignment:
| Q |
109 |
atgcggtttaatttggatcgatttttggatatc |
141 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
42199795 |
atgcggtttaatttggatcggtttttggatatc |
42199827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 1576240 - 1576204
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1576240 |
tatgcggtttaatttggatcggtttttggatatccaa |
1576204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 8080920 - 8080884
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8080920 |
tatgcggtttaatttggatcggtttttggatatccaa |
8080884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 27392981 - 27392945
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27392981 |
tatgcggtttaatttggatcggtttttggatatccaa |
27392945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 105 - 188
Target Start/End: Complemental strand, 30816634 - 30816551
Alignment:
| Q |
105 |
ttttatgcggtttaatttggatcgatttttggatatccaatttacagttttgtgaaaaaatctattaaaattactactataaag |
188 |
Q |
| |
|
||||||| ||||| |||| || | ||||||||||||||| ||| ||| ||||| |||||||||| ||||||| || ||||||| |
|
|
| T |
30816634 |
ttttatgtagtttagtttgaattggtttttggatatccaaattatagtattgtgtaaaaatctatgaaaattaatattataaag |
30816551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 121 - 150
Target Start/End: Complemental strand, 2116050 - 2116021
Alignment:
| Q |
121 |
ttggatcgatttttggatatccaatttaca |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2116050 |
ttggatcgatttttggatatccaatttaca |
2116021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 108 - 141
Target Start/End: Complemental strand, 40305851 - 40305818
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatc |
141 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
40305851 |
tatgcggtttaatttggatcaatttttggatatc |
40305818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 105 - 176
Target Start/End: Original strand, 19221209 - 19221281
Alignment:
| Q |
105 |
ttttatgcggtttaatttggatcgatttttggatatccaatttacagttttgtgaaaa-aatctattaaaatt |
176 |
Q |
| |
|
||||||| |||||| ||| ||| | |||| |||||||||| ||||| |||||| |||| |||||||||||||| |
|
|
| T |
19221209 |
ttttatgtggtttagttttgattggttttgggatatccaaattacaattttgtaaaaaaaatctattaaaatt |
19221281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 36482362 - 36482398
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
36482362 |
tatgcggtttaatttggatcggttttttgatatccaa |
36482398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 7607992 - 7608028
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7607992 |
tatgcggtttaatttggatcggtttttggatatccaa |
7608028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 16705074 - 16705110
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16705074 |
tatgcggtttaatttggatcggtttttggatatccaa |
16705110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 144
Target Start/End: Original strand, 3900840 - 3900870
Alignment:
| Q |
114 |
gtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3900840 |
gtttaatttggatcgatttttggatatccaa |
3900870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 144
Target Start/End: Original strand, 4463885 - 4463917
Alignment:
| Q |
112 |
cggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
4463885 |
cggtttaatttggatcggtttttggatatccaa |
4463917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 29174965 - 29175001
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
29174965 |
tatgcggtttaatttggatcggtttttgtatatccaa |
29175001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 30395961 - 30395925
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
30395961 |
tatgcgatttaatttggatcgctttttggatatccaa |
30395925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0396 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0396
Description:
Target: scaffold0396; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 975 - 1011
Alignment:
| Q |
108 |
tatgcggtttaatttggatcgatttttggatatccaa |
144 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
975 |
tatgcggtttaatttggatcggtttttggacatccaa |
1011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University