View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20509_low_10 (Length: 303)
Name: NF20509_low_10
Description: NF20509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20509_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 263; Significance: 1e-147; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 16 - 290
Target Start/End: Complemental strand, 7554475 - 7554201
Alignment:
| Q |
16 |
catatcactcagttccatttgcaatggaaacttcacagtcccaaatataccagtataactcttcctatcactgcaacttctctgccaccggttttccttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
7554475 |
catatcactcagttccatttgcaatggaaacttcaccgtcccaaatataccagtataactcttcctatcactgctacttctctgccaccggttttccctc |
7554376 |
T |
|
| Q |
116 |
ccggatggcgaccgcagtccggcaacaaagacattatgccgatcagacgtgttttcttcctctcttttcatcatctgcctagctgaaccgggttcagttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554375 |
ccggatggcgaccgcagtccggcaacaaagacattatgccgatcagacgtgttttcttcctctcttttcatcatctgcctagctgaaccgggttcagttt |
7554276 |
T |
|
| Q |
216 |
cgcgacttatgagttttccacagaaaataacatcctttggtggtgaagtattaaaaccagtatgaaattcgaagt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554275 |
cgcgacttatgagttttccacagaaaataacatcctttggtggtgaagtattaaaaccagtatgaaattcgaagt |
7554201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 16 - 290
Target Start/End: Complemental strand, 7544697 - 7544423
Alignment:
| Q |
16 |
catatcactcagttccatttgcaatggaaacttcacagtcccaaatataccagtataactcttcctatcactgcaacttctctgccaccggttttccttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
7544697 |
catatcactcagttccatttgcaatggaaacttcaccgtcccaaatataccagtataactcttcctatcactgctacttctctgccaccggttttccctc |
7544598 |
T |
|
| Q |
116 |
ccggatggcgaccgcagtccggcaacaaagacattatgccgatcagacgtgttttcttcctctcttttcatcatctgcctagctgaaccgggttcagttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7544597 |
ccggatggcgaccgcagtccggcaacaaagacattatgccgatcagacgtgtcttcttcctctcttttcatcatctgcctagctgaaccgggttcagttt |
7544498 |
T |
|
| Q |
216 |
cgcgacttatgagttttccacagaaaataacatcctttggtggtgaagtattaaaaccagtatgaaattcgaagt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7544497 |
cgcgacttatgagttttccacagaaaataacatcctttggtggtgaagtattaaaaccagtatgaaattcgaagt |
7544423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University