View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20509_low_16 (Length: 241)

Name: NF20509_low_16
Description: NF20509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20509_low_16
NF20509_low_16
[»] scaffold0085 (1 HSPs)
scaffold0085 (1-224)||(52440-52663)


Alignment Details
Target: scaffold0085 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: scaffold0085
Description:

Target: scaffold0085; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 52663 - 52440
Alignment:
1 tttgtaagaactttctagggttactagttgatgaaggaaaagatagtagattataatatagtaaaagaattgaattttgatatttgacacgactagaaag 100  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
52663 tttggaagaactttctagggttactagttgatgaaggaaaagatagtagattataatacagtaaaagaattgaattttgatatttgacacgactagaaag 52564  T
101 aaagaagnnnnnnntctcattccagttaatttgataagctggacatccggatcaaaaacttttgctatatgcaagtcactgttgcaaaccaatgatatga 200  Q
    |||||||       | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52563 aaagaagaaaaaaatttcattccaattaatttgataagctggacatccggatcaaaaacttttgctatatgcaagtcactgttgcaaaccaatgatatga 52464  T
201 tccaaaatggtcaattaccgaaag 224  Q
    ||||||||||||||||||||||||    
52463 tccaaaatggtcaattaccgaaag 52440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University