View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20509_low_9 (Length: 328)
Name: NF20509_low_9
Description: NF20509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20509_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 4 - 254
Target Start/End: Complemental strand, 48267905 - 48267653
Alignment:
| Q |
4 |
atgtcgaagaatatgctttagatccacta-ccaaatcaaaataacaaccacccaaaaatcactctccgtgtaaacaccaacaacacccaagactcaa-nn |
101 |
Q |
| |
|
|||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48267905 |
atgtagaaaaatatgctttagatccactaaccaaatcaaaataacaaccacccaaaaatcactctccgtgtaaacaccaacaacacccaagactcaattt |
48267806 |
T |
|
| Q |
102 |
nnnnnncccaactcatcacaatataaaaaactgcacgcataacccatttgagtcattgtttnnnnnnnnnnnnnnnnntacaaaacccatcaaaagacac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48267805 |
ttttttcccaactcatcacaatataaaaaactgcacgcataacccatttgagtcattgtttaaaaaaacctaaaaaaatacaaaacccatcaaaagacac |
48267706 |
T |
|
| Q |
202 |
atacccttttcaaatttagaggtaaaaataccattactaagaggaaaacacat |
254 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48267705 |
atacccttttcaaatttagaggtgaaaataccattactaagaggaaaacacat |
48267653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 282 - 313
Target Start/End: Complemental strand, 48267619 - 48267588
Alignment:
| Q |
282 |
cacattaacagctcaaccattaagaaagtaaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48267619 |
cacattaacagctcaaccattaagaaagtaaa |
48267588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University