View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2050_high_7 (Length: 293)
Name: NF2050_high_7
Description: NF2050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2050_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 283
Target Start/End: Original strand, 13886891 - 13887167
Alignment:
| Q |
18 |
ataaattgttcgaaaggcagatatacgcatttaaggggttgaagaaagtatggaataactaataggattacgtaaatta-----------gaggcaagtg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
13886891 |
ataaattgttcgaaaggcagatatacgcatttaaggggttgaagaaagtatggaataactaataggattacgtaaaatccaagggtaattgaggcaagtg |
13886990 |
T |
 |
| Q |
107 |
aatcttcaagagtgagaaaatgatcactcaaaaagttgaagaggttatggtgaagtaactaaacatcataaggtagttggtaagaaagtgagtctcctcg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13886991 |
aatcttcaagagtgagaaaatgatcactccaaaagttgaagaggttatggtgaagtaactaaacatcataaggtagttggtaagaaagtgagtctcctcg |
13887090 |
T |
 |
| Q |
207 |
aatttgggtatgtataatcactctagtttggttgttgctagttttgctccacatatcactagacactttgtattcat |
283 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13887091 |
aatttgggtatgtataatcactctaggttggttgtttctaattttgctccacatatcactagacactttgtattcat |
13887167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University