View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2050_low_12 (Length: 338)
Name: NF2050_low_12
Description: NF2050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2050_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 171 - 325
Target Start/End: Original strand, 48020371 - 48020525
Alignment:
| Q |
171 |
tgggtattacatgaaaagcaaattacaacaaaatgggtgacttacgccatgaaggtgagctcctaacacagcaatcaacagtaagttgttctttgacagg |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48020371 |
tgggtattacatgaaaagcaaattacaacaaaatgggttacttacgccatgaaggtgagctcctaacacagcaatcaacagtaagttgttctttgacagg |
48020470 |
T |
 |
| Q |
271 |
atgaggttgaaaatgatcaactttaccactttcaccagctgccattgtttctctt |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48020471 |
atgaggttgaaaatgatcaactttaccactttcaccagctgccattgtttctctt |
48020525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 48020200 - 48020309
Alignment:
| Q |
1 |
gatgattacattgccaccacccaacaaaggaacaagaatagtggaaacaatgaaaatggttccaagcattacaaggtagtgctgaaacccaagaaaaatc |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48020200 |
gatgattacattgccaccacccatcaaaggaacaagaatagtggaaacaatgacaatggttccaagcattacaaggtagtgttgaaacccaagaaaaatc |
48020299 |
T |
 |
| Q |
101 |
ccttcagctg |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
48020300 |
ccttcagctg |
48020309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University