View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2050_low_17 (Length: 250)
Name: NF2050_low_17
Description: NF2050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2050_low_17 |
 |  |
|
| [»] scaffold0328 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0328 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 14906 - 14668
Alignment:
| Q |
1 |
agtccatagaagtgtaaagaggtaacaatattttggtcttcaaattaataaaatttttaatttcttgatcacattgtagtagctgaaagagaatttttat |
100 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14906 |
agtccatagaattgtaaagagggaacaatattttggtcttcaaattaataaaattttaaatttcttgatcacattgtagtagctgaaagagaatttttat |
14807 |
T |
 |
| Q |
101 |
ttttcaagatcacttgaaaatttcattaatttcacaaattaaattgttcgacgacttgcattatatatagaacctaaatccgtatttcctcatattaagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14806 |
ttttcaagatcacttgaaaatttcattaatttcacaaattaaattgttcgacgacttgcattatatatagaacctaaatccgtatttcctcatattaagc |
14707 |
T |
 |
| Q |
201 |
aaattgatagatgtatatgaggatccagattctattcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14706 |
aaattgatagatgtatatgaggatccagattctattcat |
14668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University