View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2050_low_21 (Length: 234)
Name: NF2050_low_21
Description: NF2050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2050_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 215
Target Start/End: Original strand, 32295587 - 32295793
Alignment:
| Q |
15 |
aatatcaattattttaaaacgagagagtaattttatt--gacacaaaaatttaacacatcaaactcaaggaagttcccat----aataaaatgtagagat |
108 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
32295587 |
aatatcaattattttgaaacgagagagtaattttattttgacacaaaaattcaacacatcaaactcaaggaagttcccatgataaataaaatgtagggat |
32295686 |
T |
|
| Q |
109 |
gaatgaactctcccctatcataaattcagaaaatttgaacttgcttaacatgcgttaaaccggacacataacctttggaccacgtacaacaagattaaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32295687 |
gaatgaactctcccctatcataaatttagaaaatttgaacttgcttaacatgcgttaaaccggacacataacctttggaccacgtacaacaagattaaat |
32295786 |
T |
|
| Q |
209 |
tatgcac |
215 |
Q |
| |
|
||||||| |
|
|
| T |
32295787 |
tatgcac |
32295793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University