View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2050_low_7 (Length: 417)
Name: NF2050_low_7
Description: NF2050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2050_low_7 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 21 - 361
Target Start/End: Original strand, 226510 - 226850
Alignment:
| Q |
21 |
ggcgtctcccagaaatgataacaagcaacaagatcccaaagctgtaaacgtcacacttttcagtgacatcttcgccatagccatactcgggagcaacata |
120 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
226510 |
ggcgtctcccagatatgataacaagcaacaagatcccaaagctgtaaacgtcacacttttcagtgacatcttcgccatagccatactcgggagcaacata |
226609 |
T |
|
| Q |
121 |
acaaacggttcctctcatacttggtgtactactcacaccaccactctttggaatatctccactagctgaatcaaaactattcctgcgtgctctccatagg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
226610 |
acaaacggttcctctcatacttggtgtactactcacaccaccactctttggaatatctccactagctgaatcaaaactattcctgcgtgctctccatagg |
226709 |
T |
|
| Q |
221 |
tcaccactgaatccatctaaccaccaatcgatattaccactgcgattattcccgcttcttctctttcccttctttctgtccccgtataatgcatcatcac |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
226710 |
tcaccactgaatccatctaaccaccaatcgatattaccactgcgattattcccgcttcttctctttcccttctttctgtccccgtataatgcatcatcac |
226809 |
T |
|
| Q |
321 |
tcatccaccaattatcaccattgctaataccatcatcacca |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
226810 |
tcatccaccaattatcaccattgctaataccatcatcacca |
226850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 110 - 184
Target Start/End: Complemental strand, 46223396 - 46223322
Alignment:
| Q |
110 |
ggagcaacataacaaacggttcctctcatacttggtgtactactcacaccaccactctttggaatatctccacta |
184 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||| |||||||| | |||||||||| |||| ||||||||| |
|
|
| T |
46223396 |
ggagcaacataaaaaacagttcctctcatacttggagtactactaatttcaccactcttatgaatttctccacta |
46223322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University