View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20510_high_5 (Length: 375)
Name: NF20510_high_5
Description: NF20510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20510_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 323; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 29 - 359
Target Start/End: Original strand, 35482163 - 35482493
Alignment:
| Q |
29 |
gtggagaggagacgaatttcatataaaacttcagcaccaccgctatcaaagtaagatagaatctcttcatcagtgttggcctgtacaagagtgtcacgaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35482163 |
gtggagaggagacgaatttcatataaaacttcagcaccaccgctatcaaagtaagatagaatctcttcatcagtgttggcctgtacaagagtgtcacgaa |
35482262 |
T |
|
| Q |
129 |
cttgagttgcgactatgatacgattctgttcgacaccggtgatgccggtggtttcttcaagggtgggaggtgaaaagccttcacggaggagggaagtgat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35482263 |
cttgagttgcgactatgatacgattctgttcgacaccggtgatgccggtggtttcttcaagggtgggaggtgaaaagccttcacggaggagggaagtgat |
35482362 |
T |
|
| Q |
229 |
gagaggagcgtattcgtgccaggcaccgagacggttggcgaggatgtcaatgcgacctgggatgtcgaggttgtcgtattttgatggtagaggtgttggt |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35482363 |
gagaggagcgtattcgtgccaggcaccgagacggttggcgaggatgtcgatgcgacctgggatgtcgaggttgtcgtattttgatgggagaggtgttggt |
35482462 |
T |
|
| Q |
329 |
ggtggtcggaaaggttggtatagttgtttct |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35482463 |
ggtggtcggaaaggttggtatagttgtttct |
35482493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 35482159 - 35482120
Alignment:
| Q |
1 |
ccaacgtgctgctgcagcacgtttcattgtggagaggaga |
40 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
35482159 |
ccaacgtgctgctgcagcgcgtttcattgtggagaagaga |
35482120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University