View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20510_low_8 (Length: 221)
Name: NF20510_low_8
Description: NF20510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20510_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 43311759 - 43311965
Alignment:
| Q |
1 |
gtcaatggacaatgtctttgctttatgattaaaaatatataattaaaaatattctttgaaaagttcattccattaagttggaa-ttaatcttgatttaaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43311759 |
gtcaatggacaatgtctttgctttatgattaaaaatatatgattaaaa-tattctttgaaaagttcattccattaagttggaaattaatcttgatttaaa |
43311857 |
T |
|
| Q |
100 |
atgaactatagatgtcacgaatctcagaaagaaaaaagtagatcacgtgttacatttcgtggggcggcccaaaagtaataatttattttattttatttga |
199 |
Q |
| |
|
|| | ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43311858 |
attatctatagatgtcacgaatctaagaaagaaaaaagtagatcacttgttacatttcgtggggcggcccaaaagtaatagtttattttattttatttga |
43311957 |
T |
|
| Q |
200 |
ttattctt |
207 |
Q |
| |
|
||||||| |
|
|
| T |
43311958 |
ctattctt |
43311965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University