View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20511_high_8 (Length: 225)
Name: NF20511_high_8
Description: NF20511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20511_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 99 - 210
Target Start/End: Complemental strand, 40456693 - 40456581
Alignment:
| Q |
99 |
catggaagatccttcgagttctactacttctcagtactctaacaatggtgattcttgtcccattgtcacatctctgtattaccttca-cctggtgaaaat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40456693 |
catggaagatccttcgagttctactacttctcagtactctaacaatggtgattcttgtcccattgtcacatctctgtattaccttcaccctggtgaaaat |
40456594 |
T |
 |
| Q |
198 |
cctggtgctattc |
210 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40456593 |
cctggtgctattc |
40456581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University