View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20511_low_4 (Length: 349)
Name: NF20511_low_4
Description: NF20511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20511_low_4 |
 |  |
|
| [»] scaffold0140 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0140 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 13 - 290
Target Start/End: Complemental strand, 26281 - 26002
Alignment:
| Q |
13 |
aaaataatagaacctatagcatatattaagattactcatgtgaaaatgtgaaatctcttggcttgttaaaagcgaaatacaa--atcttattttcgatca |
110 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
26281 |
aaaataatagaacctataacatatattaagattactaatgtgaaaatgtgaaatcttttggcttgttaaaagcgaaatacaacgatcttattttcgatta |
26182 |
T |
 |
| Q |
111 |
tcacatatggtggggaaatccttctaatttcttgtaatgattatctttactttctttttgatgtaccatgtccatacctgtttctgatgtaacattactt |
210 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26181 |
tcacatgtggtggg-aaatccttctaatttcttgtaatgattatctttactttctttttggtgtaccatgtccatacttgtttctgatgtaacattactt |
26083 |
T |
 |
| Q |
211 |
ttttctttacttttccctaacactccgtcttgtgcctagtaaataaagaagattgatcaat-atacttttcattttaactt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
26082 |
ttttctttacttttccctaacactccgtcttgtgcctagtaaataaagaagattgatcaataatacatttcattttaactt |
26002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University