View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20511_low_5 (Length: 317)
Name: NF20511_low_5
Description: NF20511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20511_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 14 - 301
Target Start/End: Original strand, 25650417 - 25650703
Alignment:
| Q |
14 |
agaaggaaaagtgttcggatttgcaagatttgtggga-taaaatatgtacgcagtcttgaatatcaacaagaatgtgtggttttgttcttataagatatg |
112 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25650417 |
agaaggaaaagtgttaggatttgcaagatttgtgggggtaaaatatgtacgcagtcttgaatatcaacaagaatgtgtggttttgttcttataagatatg |
25650516 |
T |
 |
| Q |
113 |
cgtcaatatctcaaaattttcaaaagaagatgatgagtcatgagatgtaaaggtgaagataaaagatggagggaaagaatcaacaatggatgcaattcca |
212 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
25650517 |
-gccaatatctcaaaattttcaaaagaagatgatgagtcatgagatgtaaaggtgaagataaaagatggagggaaagaatcaacaatggatgcaatttca |
25650615 |
T |
 |
| Q |
213 |
atnnnnnnnacaatgtcttcgttaaggttgatgatgacttggagctaattttagtgcataatattaaataggtatctgagacttatagt |
301 |
Q |
| |
|
|| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25650616 |
at-ggggggacaatgtcttcattaaggttgatgatgacttggagctaattttagtgcataatattaaataggtatctgagacttatagt |
25650703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University