View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20511_low_7 (Length: 274)
Name: NF20511_low_7
Description: NF20511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20511_low_7 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 41 - 258
Target Start/End: Original strand, 10808 - 11025
Alignment:
| Q |
41 |
aaatgcacatacgtgttcactaagtagtaattggaacatggccatagaagaccaaaacaaaaagttagggaaaaatgtatcttgtgactaagacaacata |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10808 |
aaatgcacatacgtgttcactaagtagtaaatggaacatggcaataaaagaccaaaacaaaaagttagggaaaaatgtatcttgtgactaaaacaacata |
10907 |
T |
 |
| Q |
141 |
tgcaagtacttgaagttttatccttaaagtctaaatagtaatcaaagctttttatcattgaacatgctcataaacatatccctctaataaagatccatac |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10908 |
tgcaagtacttgaagttttatccttaaagtctaaatagtaatcaacgctttttatcattggacatgctcataaacatatccctctaataaagatccatac |
11007 |
T |
 |
| Q |
241 |
actttttcaagggttttg |
258 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
11008 |
actttttcaagggttttg |
11025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University