View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20511_low_8 (Length: 238)
Name: NF20511_low_8
Description: NF20511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20511_low_8 |
 |  |
|
| [»] scaffold0140 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0140 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 79 - 221
Target Start/End: Original strand, 26841 - 26995
Alignment:
| Q |
79 |
ttctatcctaccatatctttatcttgtttatgtatgtcatatcttgacaatcaaacgagcttc------------aggcctctatcaaaatttcataata |
166 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26841 |
ttctatcctaccatttctttatcttgtttatgtatgtcatatattgacaatcaaacgagcttctatcgtattatcaggcctctatcaaaatttcataata |
26940 |
T |
 |
| Q |
167 |
tgctaattatagtagataaatatgtaatttagggcatgcatgatatgattattaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26941 |
tgctaattatagtagataaatatgtaatttagggcatgcatgatatgattattaa |
26995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 24 - 64
Target Start/End: Original strand, 26360 - 26400
Alignment:
| Q |
24 |
ttaatgcggtgattgttggtggtggaaatgtgtcagtttat |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26360 |
ttaatgcggtgattgttggtggtggaaatgtgtcagtttat |
26400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 64
Target Start/End: Original strand, 10345250 - 10345290
Alignment:
| Q |
24 |
ttaatgcggtgattgttggtggtggaaatgtgtcagtttat |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
10345250 |
ttaatgcggtgattgttggtggtggaaatgcgttagtttat |
10345290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University