View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20511_low_8 (Length: 238)

Name: NF20511_low_8
Description: NF20511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20511_low_8
NF20511_low_8
[»] scaffold0140 (2 HSPs)
scaffold0140 (79-221)||(26841-26995)
scaffold0140 (24-64)||(26360-26400)
[»] chr6 (1 HSPs)
chr6 (24-64)||(10345250-10345290)


Alignment Details
Target: scaffold0140 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: scaffold0140
Description:

Target: scaffold0140; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 79 - 221
Target Start/End: Original strand, 26841 - 26995
Alignment:
79 ttctatcctaccatatctttatcttgtttatgtatgtcatatcttgacaatcaaacgagcttc------------aggcctctatcaaaatttcataata 166  Q
    |||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||            |||||||||||||||||||||||||    
26841 ttctatcctaccatttctttatcttgtttatgtatgtcatatattgacaatcaaacgagcttctatcgtattatcaggcctctatcaaaatttcataata 26940  T
167 tgctaattatagtagataaatatgtaatttagggcatgcatgatatgattattaa 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26941 tgctaattatagtagataaatatgtaatttagggcatgcatgatatgattattaa 26995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0140; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 24 - 64
Target Start/End: Original strand, 26360 - 26400
Alignment:
24 ttaatgcggtgattgttggtggtggaaatgtgtcagtttat 64  Q
    |||||||||||||||||||||||||||||||||||||||||    
26360 ttaatgcggtgattgttggtggtggaaatgtgtcagtttat 26400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 64
Target Start/End: Original strand, 10345250 - 10345290
Alignment:
24 ttaatgcggtgattgttggtggtggaaatgtgtcagtttat 64  Q
    |||||||||||||||||||||||||||||| || |||||||    
10345250 ttaatgcggtgattgttggtggtggaaatgcgttagtttat 10345290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University