View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20511_low_9 (Length: 225)

Name: NF20511_low_9
Description: NF20511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20511_low_9
NF20511_low_9
[»] chr7 (1 HSPs)
chr7 (99-210)||(40456581-40456693)


Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 99 - 210
Target Start/End: Complemental strand, 40456693 - 40456581
Alignment:
99 catggaagatccttcgagttctactacttctcagtactctaacaatggtgattcttgtcccattgtcacatctctgtattaccttca-cctggtgaaaat 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
40456693 catggaagatccttcgagttctactacttctcagtactctaacaatggtgattcttgtcccattgtcacatctctgtattaccttcaccctggtgaaaat 40456594  T
198 cctggtgctattc 210  Q
    |||||||||||||    
40456593 cctggtgctattc 40456581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University