View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20513_low_5 (Length: 304)
Name: NF20513_low_5
Description: NF20513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20513_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 20 - 187
Target Start/End: Original strand, 8712703 - 8712866
Alignment:
| Q |
20 |
aggtggacattttcgatcttaattcttgcatatccaagattacaaaatctgtcaaaaagataacttagtttacttttaccatcaagaattctactatgcc |
119 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8712703 |
aggtggacattttcgatctt----cttgcatatccaagattacaaaatctgtcaaaaagataacttagtttacttttaccatcaagaattctactatgcc |
8712798 |
T |
|
| Q |
120 |
ataaggaaatttgattgtaccatctgccaaggtgagatttatgtttgatggtttcatcttcacctttt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8712799 |
ataaggaaatttgattgtaccatctgccaaggtgagatttatgtttggtggtttcatcttcacctttt |
8712866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 20 - 187
Target Start/End: Original strand, 9064590 - 9064753
Alignment:
| Q |
20 |
aggtggacattttcgatcttaattcttgcatatccaagattacaaaatctgtcaaaaagataacttagtttacttttaccatcaagaattctactatgcc |
119 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9064590 |
aggtggacattttcgatctt----cttgcatatccaagattacaaaatctgtcaaaaagataacttagtttacttttaccatcaagaattctactatgcc |
9064685 |
T |
|
| Q |
120 |
ataaggaaatttgattgtaccatctgccaaggtgagatttatgtttgatggtttcatcttcacctttt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9064686 |
ataaggaaatttgattgtaccatctgccaaggtgagatttatgtttggtggtttcatcttcacctttt |
9064753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University