View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20513_low_8 (Length: 239)
Name: NF20513_low_8
Description: NF20513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20513_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 33303379 - 33303601
Alignment:
| Q |
1 |
ttactaatgtcataggtgttactgttactcactagtctaactgaatcatcataatctatagttgattatacttaaaagttatttgta--ctctaataata |
98 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33303379 |
ttactaatgtcatcgttgttactgttactcactagtctaactgaatcatcataatctatagttgattatacttaaaagttatttgtattctctaataata |
33303478 |
T |
|
| Q |
99 |
taccagtgaaaactacacttcaatatacaccaacattttttggcaacttcatagttacacttcaatataacatgtgctttctttgacggcaattagacca |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33303479 |
taccagtgaaaactacacttcaatatacaccaacattttttggcaacttcatagttacacttcaatataacatgtgctttctttgacggaaattagacca |
33303578 |
T |
|
| Q |
199 |
agattgtcattgttacatatgat |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33303579 |
agattgtcattgttacatatgat |
33303601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University