View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20513_low_9 (Length: 234)
Name: NF20513_low_9
Description: NF20513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20513_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 20 - 167
Target Start/End: Complemental strand, 15688385 - 15688241
Alignment:
| Q |
20 |
atgaataagatgcagatgcagttgtggtctgtttacgcctaaaaggaaacaacttgttagccgatgtcggtttacaaatgattttaggggcaggcgaact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15688385 |
atgaataagatgcagatgcagttgtggtctgtttacgcctaaaaggaaacaacttgttagccaatgtcggtttacaaatgattttagggtcaggcgaact |
15688286 |
T |
|
| Q |
120 |
cccctgatcaatccatccaaagttagacgagtgcaaacacagtcgaat |
167 |
Q |
| |
|
|||| |||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
15688285 |
cccc---tcaatcgagccaaagttagacgagtgcaaacacagtcgaat |
15688241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 15688229 - 15688180
Alignment:
| Q |
164 |
gaatctttatcaagtctagtgaggtctacgaaagttgtgggagttttaaa |
213 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||| ||||||||||||| |
|
|
| T |
15688229 |
gaatctttatcaagtctactgaggtctgcgaaagtcttgggagttttaaa |
15688180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University