View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20514_high_14 (Length: 342)
Name: NF20514_high_14
Description: NF20514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20514_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 178 - 333
Target Start/End: Original strand, 39934698 - 39934853
Alignment:
| Q |
178 |
gtcaagttgcaccaacatttttgtttatgtgaaacgaacaaagcaaattaacagtatctggaaatacaatttcaatgactatcatgaaagcaagatccct |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
39934698 |
gtcaagttgcaccaacatttttgtttatgtgaaacgaacaaagcaaattaacaggatctggaaatacaatttcaatggctatcatcaaagcaagatccct |
39934797 |
T |
|
| Q |
278 |
atcggtttcaatcacttggagaattaagccctcctttataaacatgtctttcatct |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39934798 |
atcggtttcaatcacttggagaattaagccctcctttataaacatgtctttcatct |
39934853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 18 - 118
Target Start/End: Original strand, 39934569 - 39934668
Alignment:
| Q |
18 |
gcaaccaacacatgtttgttcaaacttttgcaaccgttgttgatactccaactcattaggcgaccnnnnnnnnntaccttttccatagtttgatttgatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39934569 |
gcaaccaacacatgtttgttcaaacttttgcaaccgttgttgatactccaactcattaggcgacc-aaaaaaaataccttttccatagtttgatttgatc |
39934667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University