View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20514_low_13 (Length: 397)
Name: NF20514_low_13
Description: NF20514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20514_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 12 - 379
Target Start/End: Complemental strand, 48397914 - 48397547
Alignment:
| Q |
12 |
agagaaagagccatggcagttgaagggtagaagacatatttagggacgttgaattctctagcgacgtcaaaagcgtctgtcccaaagaggtcgacgacaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48397914 |
agagaaagagccatggcagttgaagggtagaagacatatttagggacgttgaattctctagcgacgtcaaaagcgtctgtcccaaagaggtcgacgacaa |
48397815 |
T |
|
| Q |
112 |
cagcagtgatagtatgagtttcagagagagtgttgaagttttgacggagagaagggagagaacggaggacagtgagggagatgattgtctctatcccgga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48397814 |
cagcagtgatagtatgagtttcagagagagtgttgaagttttgacggagagaagggagagaacggaggacagtgagggagatgattgtctctatcccgga |
48397715 |
T |
|
| Q |
212 |
gtttggtggaaggtctgagaaggaaactggtggaaggaaagtatgtgaaatggactttggtagagattgaagaactgttttttgagcttttgaaggtgga |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48397714 |
gtttggtggaaggtctgagaaggaaactggtggaaggaaagtatgtgaaatgaactttggtagagattgaagaactgttttttgagcttttgaaggtgga |
48397615 |
T |
|
| Q |
312 |
ccttcggtgggaatgaagaaggagatttgaagattttgattaagaataataattcttttggcaaattc |
379 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48397614 |
ccttcggtgggaatgaagaaggtgatttgaagattttgattaagaataataattcttttggcaaattc |
48397547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University