View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20514_low_15 (Length: 350)
Name: NF20514_low_15
Description: NF20514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20514_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 309
Target Start/End: Original strand, 12049816 - 12050124
Alignment:
| Q |
1 |
tgtagcggttcccattgctgtttttggatgaagaagatgtttgtggtgataaatatgaatggaaatgaataaggtttaggaataatggtgtgatatttat |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12049816 |
tgtagcggtttccattgctgtttttggatgaagaagatgtttgtggtgataaatatgaatggaaatgaataaggtttaggaataatggtgtgatatttat |
12049915 |
T |
|
| Q |
101 |
aagggaaatgtttgttttatatacaggaacgtggtcacgtgggtggtggtggcaactggggaaaattgatgggttctacgtggaatcttctttatgccta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12049916 |
aagggaaatgtttgttttatatacaggaacgtggtcacgtgggtggtggtggcaactggggaaaattgatgggttatacgtggaatcttctttatgccta |
12050015 |
T |
|
| Q |
201 |
attctaatgtatcacacgtcagatttatgtgttattttattgtgttgcgaaaaatcagggtcaatatttttatcagcattgaatagataaattgaatatt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
12050016 |
attctaatgtatcacacgtcagatttatgtgttattttattgtgttgcaaaaaatcatggtcaatatttttattagcattgaatagataaattgaatttt |
12050115 |
T |
|
| Q |
301 |
cttcgacat |
309 |
Q |
| |
|
||| ||||| |
|
|
| T |
12050116 |
ctttgacat |
12050124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University