View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20514_low_20 (Length: 311)
Name: NF20514_low_20
Description: NF20514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20514_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 33 - 294
Target Start/End: Original strand, 7296645 - 7296906
Alignment:
| Q |
33 |
tctatctttctttgccataccaaacatattcctcttggccctttacctgcacttcattctctcaccgtgtccatcgtatccaccatcatattccttggaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7296645 |
tctatctttctttgccataccaaacatattcctcttggccctttacctgcacttcattctctcaccgtgtccatcgtatccaccatcatattccttggaa |
7296744 |
T |
|
| Q |
133 |
tattactctccaccgtctctgaaatcaaagaaacacgatggttttggcgtcgatcaaaaacccctcttcaatggctactttgttttcctcttggcactcg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7296745 |
tattactctccaccgtctctgaaatcaaagaaacacgatggttttggcgtcgatcaaaaacccctcttcaatggctactttgttttcctcttggcactcg |
7296844 |
T |
|
| Q |
233 |
cccttcaggccgtgttttcttttggtcttatattttctacctatctcgtttccttcatatgt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7296845 |
cccttcaggccgtgttttcttttggtcttatattttctacctatctcgtttccttcatatgt |
7296906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 7296218 - 7296182
Alignment:
| Q |
1 |
taatacaaacatgaaccaccttcatagaattttctat |
37 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7296218 |
taatacaaacatgaaccaccttcgtagaattttctat |
7296182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University