View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20514_low_23 (Length: 278)
Name: NF20514_low_23
Description: NF20514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20514_low_23 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 104 - 278
Target Start/End: Original strand, 29119968 - 29120142
Alignment:
| Q |
104 |
tttttaaaaccctatagtcttcgatgtcgtgattagtatttactttcttgctcaaaaatttaaattgagtagtatcgagcacttttgtccatgttgaagg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29119968 |
tttttaaaaccctatagtcttcgatgtcgtgattagtatttactttcttgctcaaaaatttaaattgagtagtatcgagcacttttgtccatgttgaagg |
29120067 |
T |
 |
| Q |
204 |
ggaactttttgaagatcggttatgaaaaaagagagtgagaataaaatggccataacctatatgaagcaaagaaca |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29120068 |
ggaactttttgaagatcggttatgaaaaaagagagtgagaataaaatggccataacctatatgaagcaaagaaca |
29120142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 74 - 113
Target Start/End: Original strand, 29119047 - 29119086
Alignment:
| Q |
74 |
ggctacaacttttgcccttatcgatattggtttttaaaac |
113 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
29119047 |
ggctacgacttttgtccttatcgatattggtttttaaaac |
29119086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University