View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20514_low_26 (Length: 250)
Name: NF20514_low_26
Description: NF20514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20514_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 39236766 - 39237009
Alignment:
| Q |
1 |
tgtacactggttactctctgctctccactgcccttgctcttccctctgatggaaaggtaaggctccaccttattagtcctctatccttatttacgtaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39236766 |
tgtacactggttactctctgctctccactgcccttgctcttccctctgatggaaaggtaaggctccaccttattagtcctctatccttatttacttaaaa |
39236865 |
T |
 |
| Q |
101 |
ttattattggacttaattgcagttttggttccttatttaaataaaaccgcaacttgatcctcctattttttatcgtgcaattttggttcttcatttcaaa |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
39236866 |
ttataattggacttaattgcagttttggttccttatttaaataaaaccgtaacttgatcctcctattttttatcgtgcaattttgattcctcatttcaaa |
39236965 |
T |
 |
| Q |
201 |
ttcgttgcctaattttttattttgatcatctaatttgatgatgt |
244 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39236966 |
ttcgttgcctaattttttactttgatcatctaatttgatgatgt |
39237009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 3 - 75
Target Start/End: Complemental strand, 39292015 - 39291943
Alignment:
| Q |
3 |
tacactggttactctctgctctccactgcccttgctcttccctctgatggaaaggtaaggctccaccttatta |
75 |
Q |
| |
|
||||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39292015 |
tacacaggttactctttgctctccactgctcttgctcttccctctgatggaaaggtaaagctccaccttatta |
39291943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 3 - 73
Target Start/End: Original strand, 39054799 - 39054869
Alignment:
| Q |
3 |
tacactggttactctctgctctccactgcccttgctcttccctctgatggaaaggtaaggctccaccttat |
73 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
39054799 |
tacactggttactctcttctctccactgctcttgctcttccttctgatggaaaggtaaggctcgaccttat |
39054869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 3 - 73
Target Start/End: Original strand, 39049304 - 39049374
Alignment:
| Q |
3 |
tacactggttactctctgctctccactgcccttgctcttccctctgatggaaaggtaaggctccaccttat |
73 |
Q |
| |
|
|||||||| |||||||| ||| ||||||| ||||||||||| |||||||||||||||| |||||| ||||| |
|
|
| T |
39049304 |
tacactggctactctctactcaccactgctcttgctcttccttctgatggaaaggtaaagctccaacttat |
39049374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University