View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20514_low_27 (Length: 232)
Name: NF20514_low_27
Description: NF20514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20514_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 8354833 - 8354629
Alignment:
| Q |
18 |
atcattcccaaagcaaaaggttttaggtt-----gcaggggaagcattagcaatgtcaatgacaaaacggtaacgaacatcattcttcacaagacgctga |
112 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8354833 |
atcattcccaaagcaaagggttttaggttaggttgcaggggaagcattagcaatgtcaatgacaaaacggtaacgaacatcattcttcaaaagacgctga |
8354734 |
T |
|
| Q |
113 |
aaagcttcattgattgtatcagctttgattaattcaatgtcacatgtgatattatgcttcccacaaacatccaacatttcttgagtctcttttattcctc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8354733 |
aaagcttcattgattgtatcagctttgattaattcaatgtcacatgtgatattatgcttcccacaaacatccaacatttcttgagtctcttttattcctc |
8354634 |
T |
|
| Q |
213 |
ctatg |
217 |
Q |
| |
|
||||| |
|
|
| T |
8354633 |
ctatg |
8354629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University