View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20515_high_11 (Length: 378)
Name: NF20515_high_11
Description: NF20515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20515_high_11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 11 - 378
Target Start/End: Complemental strand, 36791471 - 36791099
Alignment:
| Q |
11 |
cacagactatttatgcttatcccaaccactacttctagtgtctctctctacatataatgtgaatgttgtttgattaacccatttta-----------att |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
36791471 |
cacagactatttatgcttatcccaaccactacttctagtgtctctctctacatataatgtgaatgttgtttgatgaacccattttactttttaacttatt |
36791372 |
T |
 |
| Q |
100 |
ctcaatggcacctactgcagcaatgcttttgctccctcaatattatggaagatcatcaatgaccctgccaccctcatcctcatccccacctaaaaccact |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36791371 |
ctcaatggcacctactgcagcaatgcttttgctccctcaatattatggaagatcatcaatgaccctgccaccctcatcc------ccacctaaaaccact |
36791278 |
T |
 |
| Q |
200 |
tattttgggatgaaagcctcatcactgaagtattggatcaccaattacatacaatccaggaatcaaaaaccaccagattcacactcatgactgtttgcat |
299 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36791277 |
tattttgggatgaaagcctcatcacttaagtattggatcaccaattacatacaatccaggaatcaaaaaccaccagattcacactcatgactgcttgcat |
36791178 |
T |
 |
| Q |
300 |
ggttgaggtttgaagatgccctttaactttgcagctgctactaatgtaatgacttatatgatccgtagagcttttgctt |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36791177 |
ggttgaggtttgaagatgccctttaactttgcagctgctactaatgtaatgacttatatgatccgtagagcttttgctt |
36791099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University