View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20515_high_18 (Length: 320)
Name: NF20515_high_18
Description: NF20515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20515_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 7 - 302
Target Start/End: Original strand, 46894213 - 46894508
Alignment:
| Q |
7 |
attgggtaagcccttttgggccaaaaaggaaggagcacaagagaagaggaaccgagggattgtaaccattgggccgggcttaggcccgttaatggcgtag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46894213 |
attgggtaagcccttttgggccaaaaaggaaggagcacaagagaagaggaactgagggattgtaaccattgggccgggcttaggcccattaatggcgtag |
46894312 |
T |
 |
| Q |
107 |
atagcgaggacatcttgagccagttcacccatagctgtttgttgagtgaccgggtttgcggacataagcccacaggtgttgttatggcaaccgggtctga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46894313 |
atagcgaggacatcttgagccagttcacccatagctgtttgttgagtgaccgggtttgcggacataagcccacaggtgttgttatggcaaccgggtctga |
46894412 |
T |
 |
| Q |
207 |
aagaagagacacacgtgtgacacgtgtgagcattggctctggagcattgggttgaatggcaatagggtgcttggtatgttgaggatgcgtagtgtt |
302 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46894413 |
aagaagagacacacgtgtgacatgtgtgagcattggctctggagcattgggttgaatggcaatagggtgcttggtatgttgaggatgcgtagtgtt |
46894508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University