View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20515_high_25 (Length: 252)
Name: NF20515_high_25
Description: NF20515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20515_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 6 - 234
Target Start/End: Complemental strand, 35644546 - 35644318
Alignment:
| Q |
6 |
caaacaagaagatatagaggaatcgagaaatcataactgttcgtcatcattttgtgttaacctattttattttctttgcatacaccaaatcctatgcaaa |
105 |
Q |
| |
|
|||||||| |||||||| ||| || || |||| |||| ||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
35644546 |
caaacaaggagatataggggattcaaggaatcctaaccgttcgtcatcattttgtgttaacctattttactttctttgcatataccaaatcctatgcaaa |
35644447 |
T |
|
| Q |
106 |
ctcccgatttattgtttttaattaagcttaatataattggtgagtcgaacaacaatccctgtaaaaacaatatctacttactacttgattgcttgtgtga |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35644446 |
ctcccgatttattgtttttaattaagcttaatataattgtcgagtcgaacaacaatctctgtaaaaacaatatctacttactacttgattacttgtgtga |
35644347 |
T |
|
| Q |
206 |
ttcggtatacttattttatttgtcataaa |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35644346 |
ttcggtatacttattttatttgtcataaa |
35644318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University