View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20515_high_27 (Length: 245)
Name: NF20515_high_27
Description: NF20515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20515_high_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 5779067 - 5779307
Alignment:
| Q |
1 |
aaaattgccaatgatacgcatttgcaagatacggtggcaaccgaaatcatgggccaggctacatataggataaacatcact---atgcttaacggctctg |
97 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
5779067 |
aaaattgccaatgatatgcatttgcaagatacggtggcaaccgaaatcatgggccaggctacatataggataaacatcactgtgatggttaacggctctg |
5779166 |
T |
|
| Q |
98 |
tggccgtcagcaacaacattgtccgagctctcgttactcggactttgtatgatcgctctccagttgctgtctacgctgtctccaaggtgttgatgccgaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5779167 |
tggccgtcagcaacaacattgtccgagctcttgttactcggactttgtatgatcgctctccaatcgctgtctacgctgtctccaaggtgttgatgccgaa |
5779266 |
T |
|
| Q |
198 |
agagcttcccgtgcccatcacctccgatgtcaccgccccta |
238 |
Q |
| |
|
||||||||||| || ||||||||| |||||||||||||||| |
|
|
| T |
5779267 |
agagcttcccgcgctcatcacctctgatgtcaccgccccta |
5779307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 5817359 - 5817548
Alignment:
| Q |
18 |
gcatttgcaagatacggtggcaaccgaaatcatgggccaggctacatataggataaacatcact---atgcttaacggctctgtggccgtcagcaacaac |
114 |
Q |
| |
|
||||||||||| | ||||||| | |||||||||| |||| || ||||| ||||||||||||| ||| ||||||||||||||||| ||||||||||| |
|
|
| T |
5817359 |
gcatttgcaagtcatggtggcagtcaaaatcatggggcaggataaatatatgataaacatcactgcaatggttaacggctctgtggccatcagcaacaac |
5817458 |
T |
|
| Q |
115 |
attgtccgagctctcgttactcggactttgtatgatcgctctccagttgctgtctacgctgtctccaaggtgttgatgccgaaagagctt |
204 |
Q |
| |
|
||||| ||||||||||||||| |||| |||||||||||||||| |||| ||| ||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
5817459 |
attgttcgagctctcgttacttggacattgtatgatcgctctctggttgttgtttacgccttctccaaggtgttgatgcccaaagagctt |
5817548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University