View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20515_high_33 (Length: 213)
Name: NF20515_high_33
Description: NF20515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20515_high_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 197
Target Start/End: Original strand, 34360849 - 34360919
Alignment:
| Q |
127 |
cgttcaaacatctgtaaatgnnnnnnnttgtgtccatagaggactttctcttagcaaaaatgactcaaaag |
197 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34360849 |
cgttcaaacatctgtaaatgaaaaaaattgtgtccatagagcactttctcttagcaaaaatgactcaaaag |
34360919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 197
Target Start/End: Original strand, 34360942 - 34360982
Alignment:
| Q |
157 |
tgtccatagaggactttctcttagcaaaaatgactcaaaag |
197 |
Q |
| |
|
|||||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
34360942 |
tgtccataaaagactttctcttagcacaaatgactcaaaag |
34360982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University