View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20515_high_33 (Length: 213)

Name: NF20515_high_33
Description: NF20515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20515_high_33
NF20515_high_33
[»] chr1 (2 HSPs)
chr1 (127-197)||(34360849-34360919)
chr1 (157-197)||(34360942-34360982)


Alignment Details
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 197
Target Start/End: Original strand, 34360849 - 34360919
Alignment:
127 cgttcaaacatctgtaaatgnnnnnnnttgtgtccatagaggactttctcttagcaaaaatgactcaaaag 197  Q
    ||||||||||||||||||||       |||||||||||||| |||||||||||||||||||||||||||||    
34360849 cgttcaaacatctgtaaatgaaaaaaattgtgtccatagagcactttctcttagcaaaaatgactcaaaag 34360919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 197
Target Start/End: Original strand, 34360942 - 34360982
Alignment:
157 tgtccatagaggactttctcttagcaaaaatgactcaaaag 197  Q
    |||||||| | ||||||||||||||| ||||||||||||||    
34360942 tgtccataaaagactttctcttagcacaaatgactcaaaag 34360982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University