View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20515_low_20 (Length: 308)
Name: NF20515_low_20
Description: NF20515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20515_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 15 - 292
Target Start/End: Original strand, 43408634 - 43408917
Alignment:
| Q |
15 |
atgagattgaatatggatccatcttttgctgatgcaggctgttgattttagaagtagtcacaacatgaatatcccacaagcagtaaaggtaa---gcaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43408634 |
atgagattgaatatggatccatcttttgctgatgcaggctgttgattttagaagtagtcacaacatgaatatcccacaagcagtaaaggtaattagcaaa |
43408733 |
T |
 |
| Q |
112 |
caatca---tcagatcatagtactggatttgattaaatcaacaaaaactaaataaaattgtttctaaaaatgatatgataatgaataattaggtatttga |
208 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408734 |
caatcatcatcagatcatagtactggatttgattagatcaacaaaaactatataaaattgtttctaaaaatgatatgataatgaataattaggtatttga |
43408833 |
T |
 |
| Q |
209 |
agagctatatgaagcagccgtgaacgagataatggaagtgttggcttcagtgtgcaagacgcacaatttaccattagcactaac |
292 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408834 |
agagctatatgaagcagcggtgaacgagataatggaagtgttggcgtcagtgtgcaagacgcacaatttaccattagcactaac |
43408917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University