View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20515_low_22 (Length: 260)
Name: NF20515_low_22
Description: NF20515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20515_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 43486585 - 43486382
Alignment:
| Q |
19 |
ggtgaggtgatgcacttgcatccctggattttaaaattacttttataatcttacannnnnnnn---aatactttgaatctcctaaaatgttaacaagtgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||| |
|
|
| T |
43486585 |
ggtgaggtgatgcacttgcatccctggattttaaaattacttttataatcttacatttttttttttaatactttaaatctcctaaaatattaacaagtgt |
43486486 |
T |
 |
| Q |
116 |
ctatgagacactagttnnnnnnncaaatataaataatttggaacttgtgtaatcactcttaaaagtgtatgtatagtttaagtagtgttaattaagttag |
215 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43486485 |
ctatgagacactagttaaataaacaaatataaataatttggaacttgtgtaatcacttttaaaagtgtatgtatagtttaagtagtgttaattaagttag |
43486386 |
T |
 |
| Q |
216 |
catg |
219 |
Q |
| |
|
|||| |
|
|
| T |
43486385 |
catg |
43486382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University