View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20515_low_27 (Length: 245)

Name: NF20515_low_27
Description: NF20515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20515_low_27
NF20515_low_27
[»] chr2 (2 HSPs)
chr2 (1-238)||(5779067-5779307)
chr2 (18-204)||(5817359-5817548)


Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 5779067 - 5779307
Alignment:
1 aaaattgccaatgatacgcatttgcaagatacggtggcaaccgaaatcatgggccaggctacatataggataaacatcact---atgcttaacggctctg 97  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||| ||||||||||||    
5779067 aaaattgccaatgatatgcatttgcaagatacggtggcaaccgaaatcatgggccaggctacatataggataaacatcactgtgatggttaacggctctg 5779166  T
98 tggccgtcagcaacaacattgtccgagctctcgttactcggactttgtatgatcgctctccagttgctgtctacgctgtctccaaggtgttgatgccgaa 197  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||    
5779167 tggccgtcagcaacaacattgtccgagctcttgttactcggactttgtatgatcgctctccaatcgctgtctacgctgtctccaaggtgttgatgccgaa 5779266  T
198 agagcttcccgtgcccatcacctccgatgtcaccgccccta 238  Q
    ||||||||||| || ||||||||| ||||||||||||||||    
5779267 agagcttcccgcgctcatcacctctgatgtcaccgccccta 5779307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 5817359 - 5817548
Alignment:
18 gcatttgcaagatacggtggcaaccgaaatcatgggccaggctacatataggataaacatcact---atgcttaacggctctgtggccgtcagcaacaac 114  Q
    |||||||||||  | |||||||  | |||||||||| |||| || ||||| |||||||||||||   ||| ||||||||||||||||| |||||||||||    
5817359 gcatttgcaagtcatggtggcagtcaaaatcatggggcaggataaatatatgataaacatcactgcaatggttaacggctctgtggccatcagcaacaac 5817458  T
115 attgtccgagctctcgttactcggactttgtatgatcgctctccagttgctgtctacgctgtctccaaggtgttgatgccgaaagagctt 204  Q
    ||||| ||||||||||||||| |||| ||||||||||||||||  |||| ||| |||||  ||||||||||||||||||| |||||||||    
5817459 attgttcgagctctcgttacttggacattgtatgatcgctctctggttgttgtttacgccttctccaaggtgttgatgcccaaagagctt 5817548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University