View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20515_low_29 (Length: 238)
Name: NF20515_low_29
Description: NF20515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20515_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 44758024 - 44758221
Alignment:
| Q |
18 |
gtactagttcaaatcagaaagttaatcccgtcgcaatttggaatagttgaaaaatgtagataatcatcccacgaacactctgcttttatgtctnnnnnnn |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44758024 |
gtactagttcaaaacagaaagttaatcccgtcgcaatttggaatagttgaaaaacgtagataatcatcccacgaacactctgcttttatgtctaaaaaaa |
44758123 |
T |
 |
| Q |
118 |
gtaactatttacaattatagactactttaatttaacctgcagttaggggatttcccaacagatattgaagctggtcaaattaagactggtttaaatttac |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44758124 |
gtaac-------------agactactttaatttaacctgcagttaggggatttcccaacagatattgaagctggtcaaattaagactggtttaaatttac |
44758210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University