View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20515_low_34 (Length: 211)
Name: NF20515_low_34
Description: NF20515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20515_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 28193221 - 28193046
Alignment:
| Q |
18 |
aatttgatgtcgatattctccaaaggtgaaattcttatacgtagaaggttctttgcagccacttatcgtagtagtgtaagaaggacataggaagtatgca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28193221 |
aatttgatgtcgatattctccaaaggtgaaattcttatacgtagaaggttctttgcagccacttatcatagtagtgtaagaaggacataggaagtatgca |
28193122 |
T |
|
| Q |
118 |
atggagtatctttccactttgtcatttgccacgaccttgtgctctacgcttttgtactcatcattactccaggcct |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28193121 |
atggagtatctttccactttgtcatttgccacgaccttgtgctctacgcttttgtactcatcattactccaggcct |
28193046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University