View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20515_low_35 (Length: 202)
Name: NF20515_low_35
Description: NF20515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20515_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 25 - 180
Target Start/End: Complemental strand, 27120655 - 27120499
Alignment:
| Q |
25 |
tgtgatagctcaaaaagtccagcgcccgatggagtaaattttaggtttgttaaagaattatgggaagatataaaagatgattttttgatgtgatggctaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27120655 |
tgtgatagctcaaaaagtccagcgccatatagagtaaattttaggtttgttaaagaattatgggaagatataaaagatgattttttgaggtgatggctaa |
27120556 |
T |
|
| Q |
125 |
attttatacaaatggtcgaatcgtcaaa-gggaaaattgttcatttgtggtgttaat |
180 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27120555 |
attttatacaaatggtcgaatcgtcaaaggggaaaattgttcatttgtggtgttaat |
27120499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University