View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20515_low_35 (Length: 202)

Name: NF20515_low_35
Description: NF20515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20515_low_35
NF20515_low_35
[»] chr5 (1 HSPs)
chr5 (25-180)||(27120499-27120655)


Alignment Details
Target: chr5 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 25 - 180
Target Start/End: Complemental strand, 27120655 - 27120499
Alignment:
25 tgtgatagctcaaaaagtccagcgcccgatggagtaaattttaggtttgttaaagaattatgggaagatataaaagatgattttttgatgtgatggctaa 124  Q
    ||||||||||||||||||||||||||  || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
27120655 tgtgatagctcaaaaagtccagcgccatatagagtaaattttaggtttgttaaagaattatgggaagatataaaagatgattttttgaggtgatggctaa 27120556  T
125 attttatacaaatggtcgaatcgtcaaa-gggaaaattgttcatttgtggtgttaat 180  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
27120555 attttatacaaatggtcgaatcgtcaaaggggaaaattgttcatttgtggtgttaat 27120499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University