View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20517_low_5 (Length: 244)
Name: NF20517_low_5
Description: NF20517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20517_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 9198585 - 9198814
Alignment:
| Q |
1 |
ttttgtttgcgtcagagataaagttgataacgagttacactttcaagttcaaaatgatagtttgtctctattttttgtccactcttaccctttttcgtaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9198585 |
ttttgtttgcgtcagagataaagttgataacgagttacacttttaagtttaaaatgatggtttgtctctattatttgtccactcttaccctttttcgtaa |
9198684 |
T |
 |
| Q |
101 |
tgaaattggaggtctaactcatccttaaataccggtttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaaccggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||| ||| |||||||||||||||| ||||||||||||||| | |
|
|
| T |
9198685 |
tgaaattggaggtctaactcatccttaaataccggtttgaattcaacaggctcttataccataataaaatttgaggtctaacgcatccttaaaaaccgat |
9198784 |
T |
 |
| Q |
201 |
tctaaatcggaagaaaagtcttatctatcc |
230 |
Q |
| |
|
||||||||||||||| |||||||||||||| |
|
|
| T |
9198785 |
tctaaatcggaagaagagtcttatctatcc |
9198814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 129
Target Start/End: Original strand, 18873184 - 18873215
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18873184 |
taatgaaattggaggtctaactcatccttaaa |
18873215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 16)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 137 - 202
Target Start/End: Complemental strand, 32034230 - 32034165
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaaccggttc |
202 |
Q |
| |
|
||||| |||| ||||||| |||||| ||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
32034230 |
ttgaaatcgacaagctctgataccataatgaaattggaggtctaactcatccttaaaaaccggttc |
32034165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 150 - 202
Target Start/End: Original strand, 19984629 - 19984681
Alignment:
| Q |
150 |
gctcttataccacaatgaaatttgaggtctaacacatccttaaaaaccggttc |
202 |
Q |
| |
|
||||| |||||| ||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
19984629 |
gctctgataccataatgaaattggaggtctaactcatccttaaaaaccggttc |
19984681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 98 - 137
Target Start/End: Original strand, 19984641 - 19984680
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19984641 |
taatgaaattggaggtctaactcatccttaaaaaccggtt |
19984680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 98 - 137
Target Start/End: Complemental strand, 32034205 - 32034166
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32034205 |
taatgaaattggaggtctaactcatccttaaaaaccggtt |
32034166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 98 - 137
Target Start/End: Original strand, 42637733 - 42637772
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42637733 |
taatgaaattggaggtctaactcatccttaaaaaccggtt |
42637772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 203
Target Start/End: Complemental strand, 40926593 - 40926527
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaaccggttct |
203 |
Q |
| |
|
||||| |||| | ||||| |||||| ||||||||| |||| ||||| |||||||||||||||||||| |
|
|
| T |
40926593 |
ttgaaatcgacaggctctaataccataatgaaattggaggcctaactcatccttaaaaaccggttct |
40926527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 156 - 202
Target Start/End: Original strand, 42637727 - 42637773
Alignment:
| Q |
156 |
ataccacaatgaaatttgaggtctaacacatccttaaaaaccggttc |
202 |
Q |
| |
|
|||||| ||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
42637727 |
ataccataatgaaattggaggtctaactcatccttaaaaaccggttc |
42637773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 202
Target Start/End: Complemental strand, 26927046 - 26926981
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaaccggttc |
202 |
Q |
| |
|
|||||| ||| | ||||| |||||| ||||||||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
26927046 |
ttgaatccgacaggctctgataccataatgaaattggaggcctaactcatccttaaaaaccggttc |
26926981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 150 - 203
Target Start/End: Original strand, 32516175 - 32516228
Alignment:
| Q |
150 |
gctcttataccacaatgaaatttgaggtctaacacatccttaaaaaccggttct |
203 |
Q |
| |
|
||||| |||||| ||||||||| |||| ||||| |||||||||||||||||||| |
|
|
| T |
32516175 |
gctctgataccataatgaaattggaggcctaactcatccttaaaaaccggttct |
32516228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 97 - 137
Target Start/End: Complemental strand, 26927206 - 26927166
Alignment:
| Q |
97 |
gtaatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
26927206 |
gtaatgaaattggaggcctaactcatccttaaaaaccggtt |
26927166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 138
Target Start/End: Original strand, 39268871 - 39268907
Alignment:
| Q |
102 |
gaaattggaggtctaactcatccttaaataccggttt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39268871 |
gaaattggaggtctaactcatccttaaaaaccggttt |
39268907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 137
Target Start/End: Complemental strand, 26927021 - 26926982
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
26927021 |
taatgaaattggaggcctaactcatccttaaaaaccggtt |
26926982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 137
Target Start/End: Original strand, 32516187 - 32516226
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
32516187 |
taatgaaattggaggcctaactcatccttaaaaaccggtt |
32516226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 129
Target Start/End: Complemental strand, 39269159 - 39269128
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39269159 |
taatgaaattggaggtctaactcatccttaaa |
39269128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 137
Target Start/End: Complemental strand, 40926568 - 40926529
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
40926568 |
taatgaaattggaggcctaactcatccttaaaaaccggtt |
40926529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 137 - 202
Target Start/End: Complemental strand, 40926920 - 40926855
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaaccggttc |
202 |
Q |
| |
|
||||| |||| | ||||| |||||| ||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
40926920 |
ttgaaatcgacaggctctgataccataatgaaattgaaggactaactcatccttaaaaaccggttc |
40926855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 137 - 195
Target Start/End: Original strand, 38948378 - 38948436
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaa |
195 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||||||| |||||||||| |||||||||||| |
|
|
| T |
38948378 |
ttgaattcgacaagctctgataccataatgaaattggaggtctaactcatccttaaaaa |
38948436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 202
Target Start/End: Complemental strand, 5266249 - 5266184
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaaccggttc |
202 |
Q |
| |
|
|||||||||| | ||||| |||||| ||||||||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
5266249 |
ttgaattcgacaggctctgataccagaatgaaattggaggcctaactcatccttaaaaaccggttc |
5266184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 202
Target Start/End: Complemental strand, 33834089 - 33834024
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaaccggttc |
202 |
Q |
| |
|
||||| |||| | ||||| |||||| ||||||||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
33834089 |
ttgaaatcgacaggctctgataccataatgaaattggaggcctaactcatccttaaaaaccggttc |
33834024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 137
Target Start/End: Complemental strand, 33834064 - 33834025
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
33834064 |
taatgaaattggaggcctaactcatccttaaaaaccggtt |
33834025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 129
Target Start/End: Original strand, 38948403 - 38948434
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38948403 |
taatgaaattggaggtctaactcatccttaaa |
38948434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 137
Target Start/End: Complemental strand, 5266223 - 5266185
Alignment:
| Q |
99 |
aatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
5266223 |
aatgaaattggaggcctaactcatccttaaaaaccggtt |
5266185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 195
Target Start/End: Complemental strand, 16565034 - 16564976
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaa |
195 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||| ||||| |||||||||||| |
|
|
| T |
16565034 |
ttgaattcgataagctctgataccatgttgaaatttaaggcctaactcatccttaaaaa |
16564976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 195
Target Start/End: Original strand, 16600628 - 16600686
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaa |
195 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||| ||||| |||||||||||| |
|
|
| T |
16600628 |
ttgaattcgataagctctgataccatgttgaaatttaaggcctaactcatccttaaaaa |
16600686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 98 - 127
Target Start/End: Complemental strand, 5266474 - 5266445
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatcctta |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5266474 |
taatgaaattggaggtctaactcatcctta |
5266445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 202
Target Start/End: Complemental strand, 25186663 - 25186598
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaaccggttc |
202 |
Q |
| |
|
|||||||||| | ||||| |||||| ||||||||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
25186663 |
ttgaattcgacaggctctgataccataatgaaattggaggcctaactcatccttaaaaaccggttc |
25186598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 137
Target Start/End: Complemental strand, 25186638 - 25186599
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
25186638 |
taatgaaattggaggcctaactcatccttaaaaaccggtt |
25186599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 137
Target Start/End: Original strand, 41456312 - 41456351
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
41456312 |
taatgaaattggaggcctaactcatccttaaaaaccggtt |
41456351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 137
Target Start/End: Original strand, 43901007 - 43901046
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
43901007 |
taatgaaattggaggcctaactcatccttaaaaaccggtt |
43901046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 137 - 202
Target Start/End: Original strand, 15968029 - 15968094
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaaccggttc |
202 |
Q |
| |
|
||||| |||| | ||||| |||||| ||||||||| | || ||||| ||||||||||||||||||| |
|
|
| T |
15968029 |
ttgaaatcgacaggctctgataccataatgaaattggcggcctaactcatccttaaaaaccggttc |
15968094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 202
Target Start/End: Original strand, 5592623 - 5592688
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaaccggttc |
202 |
Q |
| |
|
|||||||||| | |||| |||||| ||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
5592623 |
ttgaattcgacagactctgataccataatgaaattggaggtctaactcatccttaaaaaccggttc |
5592688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 98 - 137
Target Start/End: Original strand, 5592648 - 5592687
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5592648 |
taatgaaattggaggtctaactcatccttaaaaaccggtt |
5592687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 197
Target Start/End: Complemental strand, 8929985 - 8929925
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaacc |
197 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
8929985 |
ttgaattcgacaagctctgataccatgttgaaatttgaggtctaattcatccttacaaacc |
8929925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 28985641 - 28985681
Alignment:
| Q |
163 |
aatgaaatttgaggtctaacacatccttaaaaaccggttct |
203 |
Q |
| |
|
||||||||| | |||||||| |||||||||||||||||||| |
|
|
| T |
28985641 |
aatgaaattgggggtctaacccatccttaaaaaccggttct |
28985681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 202
Target Start/End: Complemental strand, 7171669 - 7171604
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaaccggttc |
202 |
Q |
| |
|
|||||||||| | ||||| |||||| ||||||||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
7171669 |
ttgaattcgacaggctctgataccataatgaaattggaggcctaactcatccttaaaaaccggttc |
7171604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 98 - 137
Target Start/End: Original strand, 47086111 - 47086150
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47086111 |
taatgaaattggaggtctaactcatccttaaaaaccggtt |
47086150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 202
Target Start/End: Original strand, 6238302 - 6238367
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaaccggttc |
202 |
Q |
| |
|
|||||||||| | ||||| |||||| ||||||||| |||| |||| ||||||||||||||||||| |
|
|
| T |
6238302 |
ttgaattcgacaggctctgataccataatgaaattggaggcataactcatccttaaaaaccggttc |
6238367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 137
Target Start/End: Original strand, 6237958 - 6237997
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
6237958 |
taatgaaattggaggcctaactcatccttaaaaaccggtt |
6237997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 137
Target Start/End: Complemental strand, 7171644 - 7171605
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
7171644 |
taatgaaattggaggcctaactcatccttaaaaaccggtt |
7171605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 137 - 203
Target Start/End: Original strand, 38871119 - 38871186
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatcctta-aaaaccggttct |
203 |
Q |
| |
|
|||||||||| ||||||| |||||| |||||||||||| ||||| |||||||| |||||||||||| |
|
|
| T |
38871119 |
ttgaattcgacaagctctgataccatgttgaaatttgaggcctaacgcatccttacaaaaccggttct |
38871186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 163 - 202
Target Start/End: Original strand, 47086112 - 47086151
Alignment:
| Q |
163 |
aatgaaatttgaggtctaacacatccttaaaaaccggttc |
202 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
47086112 |
aatgaaattggaggtctaactcatccttaaaaaccggttc |
47086151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 137
Target Start/End: Complemental strand, 47377952 - 47377913
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
47377952 |
taatgaaattggaggtctaattcatccttaaaaaccggtt |
47377913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 102 - 139
Target Start/End: Original strand, 4112779 - 4112816
Alignment:
| Q |
102 |
gaaattggaggtctaactcatccttaaataccggtttg |
139 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
4112779 |
gaaattggaggcctaactcatccttaaaaaccggtttg |
4112816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 202
Target Start/End: Complemental strand, 3640346 - 3640280
Alignment:
| Q |
137 |
ttgaattcgataag-ctcttataccacaatgaaatttgaggtctaacacatccttaaaaaccggttc |
202 |
Q |
| |
|
|||||||||| ||| |||| |||||| ||||||||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
3640346 |
ttgaattcgacaaggctctgataccataatgaaattagaggcctaactcatccttaaaaaccggttc |
3640280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 137
Target Start/End: Complemental strand, 41743650 - 41743611
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
41743650 |
taatgaaattggaggcctaactcatccttaaaaaccggtt |
41743611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 137 - 202
Target Start/End: Original strand, 14115710 - 14115775
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaaccggttc |
202 |
Q |
| |
|
||||| |||| | ||||| |||||| ||||||||| |||| | ||| ||||||||||||||||||| |
|
|
| T |
14115710 |
ttgaaatcgacaggctctgataccataatgaaattggaggcccaactcatccttaaaaaccggttc |
14115775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 98 - 127
Target Start/End: Complemental strand, 14945258 - 14945229
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatcctta |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14945258 |
taatgaaattggaggtctaactcatcctta |
14945229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 137 - 202
Target Start/End: Original strand, 45684354 - 45684419
Alignment:
| Q |
137 |
ttgaattcgataagctcttataccacaatgaaatttgaggtctaacacatccttaaaaaccggttc |
202 |
Q |
| |
|
||||| |||| | ||||| |||||| ||||||||| |||| ||||| ||||||||||||| ||||| |
|
|
| T |
45684354 |
ttgaaatcgacacgctctgataccataatgaaattggaggcctaactcatccttaaaaactggttc |
45684419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 98 - 134
Target Start/End: Original strand, 53684018 - 53684054
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccg |
134 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
53684018 |
taatgaaattggaggcctaactcatccttaaaaaccg |
53684054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 129
Target Start/End: Complemental strand, 4722137 - 4722106
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4722137 |
taatgaaattggaggtctaactcatccttaaa |
4722106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 137
Target Start/End: Complemental strand, 10485308 - 10485269
Alignment:
| Q |
98 |
taatgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
10485308 |
taatgaaattggaggcctaactcatccttaaaaaccggtt |
10485269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 101 - 137
Target Start/End: Original strand, 18607246 - 18607282
Alignment:
| Q |
101 |
tgaaattggaggtctaactcatccttaaataccggtt |
137 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
18607246 |
tgaaattggaggcctaactcatccttaaaaaccggtt |
18607282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University