View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20518_high_13 (Length: 214)
Name: NF20518_high_13
Description: NF20518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20518_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 54150043 - 54150219
Alignment:
| Q |
18 |
ggaagaaggcaaaaggagccgtacgagtttctagaaagaatggccattgcttaagaaaggtgtgaacaaattcatagacctaatagaaggaggtgttgag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54150043 |
ggaagaaggcaaaaggagccgtacgagtttccagaaagaatggccattgcttaagaaaggtgtgaacaaattcatagacctaatagaaggaggtgttgag |
54150142 |
T |
|
| Q |
118 |
attgacaactcaagtttcaccgttcaggattacatgtccatttatacgtatccttcattgcaacgattttcgatagtc |
195 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
54150143 |
attgacaactcaagtttcaccgttcaagattatatgtccatttata-gtatccttcattgcaacgattttcgatagtc |
54150219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University